We have been using the term 'mutation' pretty loosely up to this point in the course...now we need to define it more precisely: mutation-- a change in the genetic material (ie. DNA). We are going to spend some time talking about how mutations can occur and what their consequences may be to cells; we will also be looking at the ways in which cells avoid mutations by repairing DNA damage.
Why this focus? Why are mutations important? There are several reasons: 1) they may have deleterious or (rarely) advantageous consequences to an organism (or its descendants); 2) they are important to geneticists: the most common way we study something is to break it--ie., we search for or make a variant (mutant) lacking the ability to perform a process which we want to study. These genetic variants possess mutant alleles of the genes we are interested in studying. 3) Mutations are important as the major source of genetic variation which fuels evolutionary change (as we will see later when we talk about population genetics and evolution).
Let's further define mutation as a heritable change in the genetic material. This point becomes important in multicellular organisms where we must distinguish between changes in gametes (germline mutations) and changes in body cells (somatic mutations). The former are passed on to one's offspring; the latter are not but we will see they can be very important in causing cancer.
In detection of germline mutations in humans and measurement of human mutation rates we have the problem of diploidy. Most forward mutations (normal gene to mutant form) are recessive and so won't be detected unless a zygote gets two copies of the mutant allele. [Reversion or reverse mutation (mutant back to normal) is generally much less frequent because there are a lot more ways to "break" a gene than there are to reverse an existing mutation.] So how can we detect and measure rates of new mutations? We can look at dominant mutations on occuring on the autosomes and at both recessive and dominant mutations on the X chromosome, since males are hemizygous for X-linked genes. Example: achondroplasia occurs sporadically (in families with no previous history) as a result of new mutations in the gene for the fibroblast growth factor receptor. One study detected seven infants born with sporadic achondroplasia in one year among 242,257 total births recorded. So the rate (actually a frequency but we won't be concerned about the difference for the purposes of thinking about rates in this course) is 7/242,257 x 1/2 (2 alleles per zygote) = 1.4 x 10e-5.
This rate is roughly in the middle of the range reported for various human genes: those with high mutation rates like NF1 (neurofibromatosis type 1) and DMD (Duchenne muscular dystrophy) (ca. 1 x 10e-4) and those with low rates of new mutation like the Huntington's Disease gene (1 x 10e-6). This hundred-fold range shows that mutation rates per gene can be intrinsically different.
Why might this be? Two possible explanations are: 1) target size and 2) hot spots. Some genes are large, meaning that there are many bases at which mutations could alter or disrupt their function. The large target argument could well be responsible for the high rates of mutation of the NF and DMD genes, as these are known to have very large protein coding regions. Alternatively, some genes may be in regions of chromosomes which are more susceptible to genetic damage/change or may contain sequences which are more likely to be altered by spontaneous mutations; the achondroplasia gene is known to contain a hot spot of the latter type (a CpG sequence, discussed below).
From studies like these in vivo and others using human cells in vitro, the overall human mutation rate is estimated to be about 1 x 10e-6 per gene per generation. (Therefore the HD gene rate is probably more typical than the other genes mentioned above.) This rate is similar to those measured in various prokaryotic and eukaryotic microorganisms. We can use the estimated human mutation rate to determine its impact on the likelihood of changes occurring in each generation: a rate of 1 x 10e-6 mutations/gene x 5 x 10e4 genes/haploid genome = 5 x 10e-2 mutations per gamete (=5/100 or 1/20). 1/20 x 2 gametes per zygote = 1/10 chance that each zygote carries a new mutation somewhere in the genome. This seems like a very high number but we need to remember that most mutations are recessive and thus will not be expressed in the heterozygous condition.
These are of two types: transitions (purine to purine or pyrimidine to pyrimidine) and transversions (purine to pyrimidine or pyrimidine to purine). We break these down into the two categories because they can occur in different ways.
The consequences of base substitution mutations in protein coding regions of a gene depend on the substitution and its location. They may be silent, not resulting in a new amino acid in the protein sequence, eg. GCA or GCG codons in mRNA both mean arginine [this is often true in the third position of a codon, especially with transitions because of "wobble" base pairing]. A base substitution could also result in an amino acid substitution; this is referred to as a missense mutation. For example, CTC in the DNA sense strand [GAG in mRNA] will specify a glutamate residue in the protein; this is altered to CAC in the DNA or GUG in the mRNA, resulting in a valine residue in the beta-globin protein chain causing sickle-cell anemia. Missense mutations may have very serious consquences, as in the case of sickle-cell anemia, mild consequences as in the case of hemoglobin C (a different amino acid substitution in position 6 of beta-globin) or no phenotype as in the case of two known amino acid substitutions at position 7 of beta-globin. Finally, base substitutions in a protein coding region may mutate an amino acid codon to a termination codon or vice versa. The former type, which results in a prematurely shortened protein is referred to as a nonsense mutation. The effects of nonsense mutations are variable depending upon how much of the truncated protein is present and is required for its function.
Base substitution mutations may also occur in promoters or 5' regulatory regions of genes or in introns and may affect their transcription, translation, or splicing. Many of the beta-thalassemias are the result of these types of non-structural mutations that affect the level of expression of the globin genes. All of the types of mutation described above have been observed in human globin genes. Their consequences depend on what they do to the level of expression of the gene product and/or on what amino acid substitution may have occurred and where it is in the protein.
These result from the insertion or deletion of one or more (not in multiples of three) nucleotides in the coding region of a gene. This causes an alteration of the reading frame: since codons are groups of three nucleotides, there are three possible reading frames for each gene although only one is used.
eg. mRNA with sequence AUG CAG AUA AAC GCU GCA UAA
amino acid sequence from the first reading frame: met gln ile
asn ala ala stop
the second reading frame gives: cys arg stop
A mutation of this sort changes all the amino acids downstream and is very likely to create a nonfunctional product since it may differ greatly from the normal protein. Further, reading frames other than the correct one often contain stop codons which will truncate the mutant protein prematurely.
Another mutatgenic process occurring in cells is spontaneous base degradation. The deamination of cytosine to uracil happens at a significant rate in cells.
Deamination can be repaired by a specific repair process which detects uracil, not normally present in DNA; otherwise the U will cause A to be inserted opposite it and cause a C:G to T:A transition when the DNA is replicated.
Deamination of methylcytosine to thymine can also occur. Methylcytosine occurs in the human genome at the sequence 5'CpG3', which is normally avoided in the coding regions of genes. If the meC is deaminated to T, there is no repair system which can recognize and remove it (because T is a normal base in DNA). This means that wherever CpG occurs in genes it is a "hot spot" for mutation. Such a hot spot has recently been found in the achondroplasia gene.
A third type of spontaneous DNA damage that occurs frequently is damage to the bases by free radicals of oxygen. These arise in cells as a result of oxidative metabolism and also are formed by physical agents such as radiation. An important oxidation product is 8-hydroxyguanine, which mispairs with adenine, resulting in G:C to T:A transversions.
Still another type of spontaneous DNA damage is alkylation, the addition of alkyl (methyl, ethyl, occasionally propyl) groups to the bases or backbone of DNA. Alkylation can occur through reaction of compounds such as S-adenosyl methionine with DNA. Alkylated bases may be subject to spontaneous breakdown or mispairing.
Example:
5' AGTCAATCCATGAAAAAATCAG 3'
3' TCAGTTAGGTACTTTTTTAGTC 5'
He proposed that these frameshifts are the result of "slipped mispairing" between the template DNA strand and the newly synthesized strand during DNA replication. In the sequence above, a likely spot for frameshift mutations to occur would be in the stretch of 6 A:T base pairs. Subsequent studies with genes from other organisms, including humans, have shown that runs of repeated nucleotides are indeed hotspots for frameshift mutations.
It is possible to distinguish chemical mutagens by their modes of action; some of these cause mutations by mechanisms similar to those which arise spontaneously while others are more like radiation (to be considered next) in their effects.
All are flat, multiple ring molecules which interact with bases of DNA and insert between them. This insertion causes a "stretching" of the DNA duplex and the DNA polymerase is "fooled" into inserting an extra base opposite an intercalated molecule. The result is that intercalating agents cause frameshifts.
The longest waves (AM radio) have the least energy while successively shorter waves and increasing energy are seen with FM radio, TV, microwaves, infrared, visible, ultraviolet (UV), X and gamma radiation. The portion which is biologically significant is UV and higher energy radiation.
UV radiation is not ionizing but can react with DNA and other biological molecules and is also important as a mutagen.
The units now used for ionizing radiation of all types are rems (roentgen equivalent man): 1 rem of any ionizing radiation produces similar biological effects. The unit used previously was the rad (radiation absorbed dose). However, the effects of different types of radiation differ for one rad unit: one rad of alpha particles has a much greater damaging effect than one rad of gamma rays; alpha particles have a greater RBE (relative biological effectiveness) than gamma rays. The relationship between these units is that:
# rads x RBE = # rems
In addition to the energy type and total dose of radiation the dose rate should be considered: the same number of rems given in a brief, intense exposure (high dose rate) causes burns and skin damage versus a long-term weak exposure (low dose rate) which would only increase risk of mutation and cancer.
In addition, humans have created artificial sources of radiation which contribute to our radiation exposure. Among these are medical testing (diagnostic X-rays and other procedures), nuclear testing and power plants, and various other products (TV's, smoke detectors, airport X-rays).
Taken together, our overall total average exposure from all sources is about 350 mrem/year; the major contributor of which is from radon exposure. See the graph on page 281 of your text for the breakdown.
sublethal dose (100-250 rems): nausea and vomiting early; 1-2 wk. latent period followed by malaise, anorexia, diarrhea, hair loss, recovery (latency due to time it takes hematopoetic or other damage to show up)
lethal dose (350-450 rems): nausea and vomiting early; 1 wk. latent period followed by above with more severe symptoms including internal bleeding; a 50% chance of death [LD50 : dose at which half of exposed individuals will die; ca. 400 rems for humans]. Death is due to blood cell or gastrointestinal failure.
supralethal dose (>650 rems): nausea and vomiting early, followed by shock, abdominal pain, diarrhea, fever and death within hours or days. Death is due to heart or CNS damage.
For the affected tissues and organs, the number of destroyed cells and the likelihood of their replacement determines the survival chances. The long term effects include increased cancer risk and increased risk of mutations in one's offspring.
UV is normally classified in terms of its wavelength: UV-C (180-290 nm)--"germicidal"--most energetic and lethal, it is not found in sunlight because it is absorbed by the ozone layer; UV-B (290-320 nm)--major lethal/mutagenic fraction of sunlight; UV-A (320 nm--visible)--"near UV"--also has deleterious effects (primarily because it creates oxygen radicals) but it produces very few pyrimidine dimers. Tanning beds will have UV-A and UV-B. To see a graphic representation of the wavelengths of UV and ozone absorption, click here.
The major lethal lesions are pyrimidine dimers in DNA (produced by UV-B and UV-C)--these are the result of a covalent attachment between adjacent pyrimidines in one strand. This is shown here for a thymine-thymine dimer and here for a thymine-cytosine dimer. These dimers, like bulky lesions from chemicals, block transcription and DNA replication and are lethal if unrepaired. They can stimulate mutation and chromosome rearrangement as well.
damage reversal--simplest; enzymatic action restores normal structure without breaking backbone
damage removal--involves cutting out and replacing a damaged or inappropriate base or section of nucleotides
damage tolerance--not truly repair but a way of coping with damage so that life can go on
We will look at examples of each type of repair, the mechanisms, the consequences of mutations in each, in both model organisms and in humans.
The photolyase enzyme catalyzes this reaction; it is found in many bacteria, lower eukaryotes, insects, and plants. It seems to be absent in mammals (including humans). The gene is present in mammals but may code for a protein with an accessory function in another type of repair.
There are other specific glycosylases for particular types of DNA damage caused by radiation and chemicals.
Human mismatch repair proteins have recently been identified and are very similar to those of the prokaryote E. coli and the simple eukaryote yeast (this is an old invention of cells); mutations are found to be passed in the germline of families with some types of inherited colon cancer (HPNCC).
Mutants that are defective in NER have been isolated in many organisms and are sensitive to killing and mutagenesis by UV and chemicals which act like UV. Humans with the hereditary disease xeroderma pigmentosum are sunlight-sensitive, they have very high risks of skin cancers on sun-exposed areas of the body and have defects in genes homologous to those required for NER in simple eukaryotes. NER mutants in lower organisms are UV-sensitive and have elevated levels of mutation and recombination induced by UV (because they are unable to use the accurate NER method to remove pyrimidine dimers and must use mutagenic or recombinogenic systems).
However, in eukaryotes, DNA replication initiates at multiple sites and it may be able to resume downstream of a dimer, leaving a "gap" of single-stranded unreplicated DNA. The gap is potentially just as dangerous if not more so than the dimer if the cell divides. So there is a way to repair the gap by recombination with either the other homolog or the sister chromatid--this yields two intact daughter molecules, one of which still contains the dimer.
A second type of recombinational repair which is used primarily to repair broken DNA ends such as are caused by ionizing radiation and chemical mutagens with similar action is the non-homologous end-joining reaction. This repair system is also employed by B and T cells of the immune system for genetic rearrangements needed for their function. The Ku70, Ku80, and DNA-dependent protein kinase proteins are needed for non-homologous end-joining. Rodent cell lines with mutations in these genes are very sensitive to killing by ionizing radiation and defective in immune system rearrangement.
The defect in AT is one in a cell cycle checkpoint, a decision point that governs progression through the next phase of the cell cycle. There are genetically controlled checkpoints that decide entry into a new cell cycle (G0 to G1 point), the decision to replicate the DNA (G1 to S point), and the decision to divide (G2 to M point). Mutations in the checkpoint genes can lead to uncontrolled cell growth, ie. cancer.
Although AT itself is a rare condition, it has been estimated that the frequency of heterozygotes with one AT mutation is about 1% in the population. These individuals also have a higher cancer risk and intermediate radiation sensitivity. Thus, screening by X-ray methods (eg. mammography) may increase the chances of an AT heterozygote developing cancer.
